si:ch211-207c7.1

Ensembl ID:
ENSDARG00000071416
ZFIN ID:
ZDB-GENE-050208-781
Description:
hypothetical protein LOC562625 [Source:RefSeq peptide;Acc:NP_001038454]
Human Orthologue:
GNA15
Human Description:
guanine nucleotide binding protein (G protein), alpha 15 (Gq class) [Source:HGNC Symbol;Acc:4383]
Mouse Orthologue:
Gna15
Mouse Description:
guanine nucleotide binding protein, alpha 15 Gene [Source:MGI Symbol;Acc:MGI:95770]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37509 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37509
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105570 Nonsense 19 107 1 2
ENSDART00000143075 Nonsense 213 361 5 7
Genomic Location (Zv9):
Chromosome 22 (position 22275469)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21928717
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTACCTAATTTTATGTTTTATTTTTTTAGGTTTATCAATGTCGGTGGT[C/T]AGAGAGGACAAAGGAGGAAATGGATCCATCACTTTGAAAATGTGACAACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Heart failure: Association of genome-wide variation with the risk of incident heart failure in adults of European and African ancestry: a prospective meta-analysis from the cohorts for heart and aging research in genomic epidemiology (CHARGE) consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link