cks2

Ensembl ID:
ENSDARG00000071410
ZFIN ID:
ZDB-GENE-050208-508
Description:
cyclin-dependent kinases regulatory subunit-like [Source:RefSeq peptide;Acc:NP_001038434]
Human Orthologue:
CKS2
Human Description:
CDC28 protein kinase regulatory subunit 2 [Source:HGNC Symbol;Acc:2000]
Mouse Orthologue:
Cks2
Mouse Description:
CDC28 protein kinase regulatory subunit 2 Gene [Source:MGI Symbol;Acc:MGI:1913447]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa29771 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29771
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105546 Nonsense 63 78 2 3
ENSDART00000135388 Nonsense 63 78 2 4
Genomic Location (Zv9):
Chromosome 22 (position 21636039)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21289287
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGACTGGGAGTCCAGCAAAGTCAGGGCTGGATTCATTACATGATCCAT[A/T]AACCAGGTTAGTATTCTTGGACATCTAATAACATTATCTAAAACCTACTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link