arl3

Ensembl ID:
ENSDARG00000071409
ZFIN IDs:
ZDB-GENE-030131-7518, ZDB-GENE-050417-368
Description:
ADP-ribosylation factor-like protein 3 [Source:UniProtKB/Swiss-Prot;Acc:Q1MTE5]
Human Orthologue:
ARL3
Human Description:
ADP-ribosylation factor-like 3 [Source:HGNC Symbol;Acc:694]
Mouse Orthologue:
Arl3
Mouse Description:
ADP-ribosylation factor-like 3 Gene [Source:MGI Symbol;Acc:MGI:1929699]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35344 Essential Splice Site Mutation detected in F1 DNA During 2016
sa6267 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35344
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105545 Essential Splice Site 1 182 1 6
Genomic Location (Zv9):
Chromosome 12 (position 35468974)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33871755
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCTTAGTAACCCTCGGCGGCGTCTCAGGGAGGCAGAATCACAAGATGG[T/G]GAGTTAAAGCGCTTATAATAAACGAATTTCAACATGTAGACTCCTTCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6267
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105545 Nonsense 73 182 3 6
Genomic Location (Zv9):
Chromosome 12 (position 35467729)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33870510
KASP Assay ID:
554-5380.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAATCACAAGGATTCAAATTAAATGTGTGGGATATTGGTGGTCAGCGA[A/T]AGATCAGGCCCTACTGGAGAAACTACTTTGARAACACAGATGTACTGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link