LOC100148088

Ensembl ID:
ENSDARG00000071406
Human Orthologue:
C17orf56
Human Description:
chromosome 17 open reading frame 56 [Source:HGNC Symbol;Acc:26458]
Mouse Orthologue:
2410002I01Rik
Mouse Description:
RIKEN cDNA 2410002I01 gene Gene [Source:MGI Symbol;Acc:MGI:1926027]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2667 Essential Splice Site Mutation detected in F1 DNA During 2014
sa4476 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2667
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105533 Essential Splice Site 13 564 1 13
Genomic Location:
Chromosome 12 (position 36495528)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTCCATCATGGYTTCAATACTGGAACGGTTGGTCTTCCTACAAAAAG[T/A]ACGTATCCKCGACACCGGGCAAAATAACGTCATTTCAGCTGTCGCTATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4476
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105533 Nonsense 114 564 5 13
Genomic Location:
Chromosome 12 (position 36489703)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTAGTTTACAGTGGGCCACCAGATCCTATACATGGAAATGCTCTCTA[T/G]CAGAAAGTCMGAAGCTCGGCTCAGGTATAATTGTCTTTCTGTACAGATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8b82zjza