camk2g1

Ensembl ID:
ENSDARG00000071395
ZFIN IDs:
ZDB-GENE-050913-146, ZDB-GENE-070323-2
Description:
calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma 1 [Source:RefSeq peptide;Acc:NP_0
Human Orthologue:
CAMK2G
Human Description:
calcium/calmodulin-dependent protein kinase II gamma [Source:HGNC Symbol;Acc:1463]
Mouse Orthologue:
Camk2g
Mouse Description:
calcium/calmodulin-dependent protein kinase II gamma Gene [Source:MGI Symbol;Acc:MGI:88259]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31890 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31890
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105518 Essential Splice Site 392 560 16 21
ENSDART00000137139 Essential Splice Site 371 405 15 16

The following transcripts of ENSDARG00000071395 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 35961097)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35260798
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGAGAGCTGCAACACCAATGAAGAAGAGGATATGAAAGGTAGGAAAGG[T/C]ACACAGATCCTCTCCTCCTGTTCTCTGCATGCCTACTGCACTGCGGCCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link