foxq2

Ensembl ID:
ENSDARG00000071394
ZFIN ID:
ZDB-GENE-050208-663
Description:
forkhead box Q2 [Source:RefSeq peptide;Acc:NP_001098411]
Human Orthologues:
FOXF1, FOXF2, FOXG1, FOXK1, FOXK2, FOXQ1
Human Descriptions:
forkhead box F1 [Source:HGNC Symbol;Acc:3809]
forkhead box F2 [Source:HGNC Symbol;Acc:3810]
forkhead box G1 [Source:HGNC Symbol;Acc:3811]
forkhead box K1 [Source:HGNC Symbol;Acc:23480]
forkhead box K2 [Source:HGNC Symbol;Acc:6036]
forkhead box Q1 [Source:HGNC Symbol;Acc:20951]
Mouse Orthologues:
3110039M20Rik, Foxf1a, Foxf2, Foxg1, Foxk1, Foxk2, Foxq1
Mouse Descriptions:
forkhead box F1a Gene [Source:MGI Symbol;Acc:MGI:1347470]
forkhead box F2 Gene [Source:MGI Symbol;Acc:MGI:1347479]
forkhead box G1 Gene [Source:MGI Symbol;Acc:MGI:1347464]
forkhead box K1 Gene [Source:MGI Symbol;Acc:MGI:1347488]
forkhead box K2 Gene [Source:MGI Symbol;Acc:MGI:1916087]
forkhead box Q1 Gene [Source:MGI Symbol;Acc:MGI:1298228]
RIKEN cDNA 3110039M20 gene Gene [Source:MGI Symbol;Acc:MGI:1914543]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37499 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37499
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105519 Nonsense 159 244 2 2
ENSDART00000136744 Nonsense 78 104 2 2
Genomic Location (Zv9):
Chromosome 22 (position 20749344)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20404020
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAGTGCTTCATCAAAGCTGGTCGCAGTGACAATGGCAAGGGTCATTTCT[G/A]GGCAATTCACCCGGCCAACTTTCAAGACTTCTCAAACGGGGACTACCATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link