hsd11b3a

Ensembl ID:
ENSDARG00000071377
ZFIN ID:
ZDB-GENE-040426-1002
Description:
Hydroxysteroid 11-beta-dehydrogenase 1-like protein [Source:UniProtKB/Swiss-Prot;Acc:Q6PUF3]
Human Orthologue:
HSD11B1L
Human Description:
hydroxysteroid (11-beta) dehydrogenase 1-like [Source:HGNC Symbol;Acc:30419]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10947 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10947
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061739 Nonsense 104 287 3 6
ENSDART00000105315 Nonsense 25 208 4 7
ENSDART00000130468 Nonsense 104 288 3 7
Genomic Location:
Chromosome 22 (position 19874045)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCCTGCGGACATGGCCAACCCCTCTGATGCCGATCTTGTGGTGAAGTA[T/A]GCCATCGAACAGCTTGGAGGACTGGATTACCTGGTTCTGAACCACATCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/eg2owmtq