celf5

Ensembl ID:
ENSDARG00000071375
ZFIN ID:
ZDB-GENE-050208-746
Description:
CUG-BP- and ETR-3-like factor 5 [Source:RefSeq peptide;Acc:NP_001124260]
Human Orthologue:
CELF5
Human Description:
CUGBP, Elav-like family member 5 [Source:HGNC Symbol;Acc:14058]
Mouse Orthologue:
Celf5
Mouse Description:
CUGBP, Elav-like family member 5 Gene [Source:MGI Symbol;Acc:MGI:2442333]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37495 Nonsense Mutation detected in F1 DNA During 2017
sa43814 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37495
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093310 Nonsense 177 597 1 11
ENSDART00000093312 Nonsense 107 506 1 11
Genomic Location (Zv9):
Chromosome 22 (position 20329487)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 19986180
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAAATCCACGAATTGACAGTATTAAAGGACCGATACACCGGCATGCAC[A/T]AAGGTAAACGCGTGATTCCCTTAATGAGAGTGTGATTTGAGCTTGTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43814
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093310 Nonsense 229 597 4 11
ENSDART00000093312 Nonsense 158 506 4 11
Genomic Location (Zv9):
Chromosome 22 (position 20060957)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 19717650
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGATTCGTGCTGTTTTTCTTTGCTTCAGAAGACAGGAAGCTGTTCGTC[G/T]GAATGCTGAACAAACAGCAGACGGAGGAGGACGTGTACCGTCTTTTTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link