si:ch211-197g15.10

Ensembl ID:
ENSDARG00000071361
ZFIN ID:
ZDB-GENE-050208-617
Description:
hypothetical protein LOC555357 [Source:RefSeq peptide;Acc:NP_001122156]
Human Orthologues:
IFI44, IFI44L
Human Descriptions:
interferon-induced protein 44 [Source:HGNC Symbol;Acc:16938]
interferon-induced protein 44-like [Source:HGNC Symbol;Acc:17817]
Mouse Orthologues:
H28, Ifi44
Mouse Descriptions:
histocompatibility 28 Gene [Source:MGI Symbol;Acc:MGI:95975]
interferon-induced protein 44 Gene [Source:MGI Symbol;Acc:MGI:2443016]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37487 Nonsense Mutation detected in F1 DNA During 2017
sa43808 Nonsense Mutation detected in F1 DNA During 2017
sa29754 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37487
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105458 Nonsense 181 483 2 8
ENSDART00000105459 Nonsense 167 469 4 10
ENSDART00000142267 Nonsense 190 492 2 8
Genomic Location (Zv9):
Chromosome 22 (position 17681649)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17432584
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACTGTTTGGAAATGTTAGCGCAATGAATGCATTCAATTTTAATTCTT[C/A]AACACTATATGGAAACGACTGTGCCCTGACTGAATGTGAGGTGTACAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43808
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105458 Nonsense 233 483 4 8
ENSDART00000105459 Nonsense 219 469 6 10
ENSDART00000142267 Nonsense 242 492 4 8
Genomic Location (Zv9):
Chromosome 22 (position 17681306)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17432241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATCTGTCACAGACAAAAAGCAGAGCTCATGGAAATGATCAGGAATTAT[A/T]AACCCCTGACATCTTCTGTCAGCCATATTCGAATCCTGATGATTGGTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29754
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105458 Essential Splice Site 336 483 5 8
ENSDART00000105459 Essential Splice Site 322 469 7 10
ENSDART00000142267 Essential Splice Site 345 492 5 8
Genomic Location (Zv9):
Chromosome 22 (position 17680924)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17431859
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGGACATCAGCAGCATTCTTCAAGGACAAATACCAGACCGCTATAAA[G/A]TAAGAGCACTTACTGAATCTCCAAAATGAATGAAGACTGAAGTGTGAATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link