morn2

Ensembl ID:
ENSDARG00000071360
ZFIN ID:
ZDB-GENE-060825-230
Description:
Zgc:153064 protein [Source:UniProtKB/TrEMBL;Acc:Q0P4E0]
Human Orthologue:
MORN2
Human Description:
MORN repeat containing 2 [Source:HGNC Symbol;Acc:30166]
Mouse Orthologue:
Morn2
Mouse Description:
MORN repeat containing 2 Gene [Source:MGI Symbol;Acc:MGI:2674071]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23080 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23080
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105457 Essential Splice Site 99 132 5 5
Genomic Location:
Chromosome 17 (position 24510026)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAAGACCAAAGAGCACCAGAGGCATAAAGTCTGAATTCATCTTTTTCA[G/A]ATTCGAGGGTGACGGGGAGTTCACAGATTCACAAGGACTCGTGTGGACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n4b9844j