Q1LYC1_DANRE

Ensembl ID:
ENSDARG00000071357
Description:
Novel protein similar to vertebrate mitogen-activated protein kinase kinase kinase kinase 3 (MAP4K3)
Human Orthologue:
MAP4K3
Human Description:
mitogen-activated protein kinase kinase kinase kinase 3 [Source:HGNC Symbol;Acc:6865]
Mouse Orthologue:
Map4k3
Mouse Description:
mitogen-activated protein kinase kinase kinase kinase 3 Gene [Source:MGI Symbol;Acc:MGI:2154405]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12892 Nonsense Available for shipment Available now
sa36410 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36411 Nonsense Mutation detected in F1 DNA During 2017
sa18499 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12892
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093004 Nonsense 3 864 1 33
Genomic Location (Zv9):
Chromosome 17 (position 24460604)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24614046
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAACGTAAATAAACCGGAGGGCGCAAACGGTGACTCGCACGATGAATT[T/A]AAGCTTGGATCTATCGCGCAGAAACCCACAGGAGGACTTTGAGCTGATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36410
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093004 Essential Splice Site 153 864 7 33
Genomic Location (Zv9):
Chromosome 17 (position 24468971)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24622413
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCAGGGTGCAAATATACTGTTAACAGACAACGGCTATGTTAAGCTAGG[T/A]AACAAAACACATTTATTGGAGATCACAGTTATTCAGAAGCACTAACCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36411
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093004 Nonsense 652 864 27 33
Genomic Location (Zv9):
Chromosome 17 (position 24486353)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24639795
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACAGTTTAACATGAATTGTTTGTGTATGTATGTAGTGCGAAACCCGTA[C/A]ACAGGTCACAAGTACCTCTGTGGAGCTTTCCAGTCCAGTGTAATGCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18499
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093004 Essential Splice Site 794 864 31 33
Genomic Location (Zv9):
Chromosome 17 (position 24488213)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24641655
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGGAATTAATYGTTTGCTTWAAATGATAATTATATATGTCCTTTTCAA[G/T]TGTGTCTGCAGGACAGTGTTTTGGCGTTCTGGAAGCATGGAATGCAGGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link