si:ch211-197g15.7

Ensembl ID:
ENSDARG00000071355
ZFIN ID:
ZDB-GENE-030131-4763
Description:
Novel protein similar to vertebrate interferon-induced protein 44 (IFI44) [Source:UniProtKB/TrEMBL;A
Human Orthologues:
IFI44, IFI44L
Human Descriptions:
interferon-induced protein 44 [Source:HGNC Symbol;Acc:16938]
interferon-induced protein 44-like [Source:HGNC Symbol;Acc:17817]
Mouse Orthologues:
H28, Ifi44
Mouse Descriptions:
histocompatibility 28 Gene [Source:MGI Symbol;Acc:MGI:95975]
interferon-induced protein 44 Gene [Source:MGI Symbol;Acc:MGI:2443016]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13424 Nonsense Available for shipment Available now
sa25179 Nonsense Mutation detected in F1 DNA During 2017
sa13418 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13424
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105453 Nonsense 223 491 4 8
Genomic Location (Zv9):
Chromosome 22 (position 17701817)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17452752
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGGTTATTTTTTGATATGGTAATTTGTAATAATAAACTTTTTTGTAGA[C/T]GAAAAGCAGAGCTCATGGGGTTAATCAGAAGTCATAAACCCCTGATTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25179
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105453 Nonsense 330 491 5 8
Genomic Location (Zv9):
Chromosome 22 (position 17701408)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17452343
KASP Assay ID:
554-7759.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGCAATCAGGAGCAGGACTGGACATTGAGGACATCAGCAGCATTCTT[C/T]AAGGACACATACCAGACCGCTACAAAGTAAGAGCATAAGTTCATTTTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13418
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105453 Essential Splice Site 338 491 5 8
Genomic Location (Zv9):
Chromosome 22 (position 17701380)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17452315
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGGACATCAGCAGCATTCTTCAAGGACACATACCAGACCGCTACAAAG[T/C]AAGAGCATAAGTTCATTTTTAGGGGCTTGGAAATGTATATTTGTTTGTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link