abch1

Ensembl ID:
ENSDARG00000071341
ZFIN ID:
ZDB-GENE-050517-42
Description:
Novel ABC transporter domain containing protein [Source:UniProtKB/TrEMBL;Acc:Q1LYA9]
Human Orthologue:
ABCA3
Human Description:
ATP-binding cassette, sub-family A (ABC1), member 3 [Source:HGNC Symbol;Acc:33]
Mouse Orthologues:
Abca14, Abca15, Abca16, Abca17, Abca3
Mouse Descriptions:
ATP-binding cassette, sub-family A (ABC1), member 14 Gene [Source:MGI Symbol;Acc:MGI:2388708]
ATP-binding cassette, sub-family A (ABC1), member 15 Gene [Source:MGI Symbol;Acc:MGI:2388709]
ATP-binding cassette, sub-family A (ABC1), member 16 Gene [Source:MGI Symbol;Acc:MGI:2388711]
ATP-binding cassette, sub-family A (ABC1), member 17 Gene [Source:MGI Symbol;Acc:MGI:3625331]
ATP-binding cassette, sub-family A (ABC1), member 3 Gene [Source:MGI Symbol;Acc:MGI:1351617]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13734 Essential Splice Site Available for shipment Available now
sa16904 Nonsense Available for shipment Available now
sa23078 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13734
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105435 None None 232 None 8
ENSDART00000105437 Essential Splice Site 41 146 None 3
ENSDART00000135086 Essential Splice Site 47 705 None 19
Genomic Location:
Chromosome 17 (position 24392693)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTTAAAGTTCTCAACAATCTCAACCTGACATTACCTCAGGGTCAAATG[T/A]GAGTTCAGCATTTTCTGTTTCGAAATGTGTTWACARATGCTGCGCCAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16904
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105435 Nonsense 72 232 2 8
ENSDART00000105437 None None 146 None 3
ENSDART00000135086 Nonsense 432 705 10 19
Genomic Location:
Chromosome 17 (position 24380990)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGGAATACTGGGGAGTCATAGAGTTTGGAGAGAATTTCACCAGCTATT[T/A]AACTAAAAGGTAAGCGCSAGTGTTTYACAAGTTTGAAATGTTCAACCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23078
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105435 Nonsense 185 232 7 8
ENSDART00000105437 None None 146 None 3
ENSDART00000135086 Nonsense 545 705 15 19
Genomic Location:
Chromosome 17 (position 24378421)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTGTCTTTTGTGCTAGAGAGGAAGGAGGGTCTGTTAGACAGATGCTG[G/A]GTGGCAGGTGAGATAGCTCACATCCACCAGATACCCATCATTTCACATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vmtahv2i