mef2bnb

Ensembl ID:
ENSDARG00000071339
ZFIN ID:
ZDB-GENE-050208-757
Description:
UPF0402 protein [Source:UniProtKB/Swiss-Prot;Acc:A3KQI3]
Human Orthologues:
AC002126.5, AC002126.6
Human Description:
UPF0402 protein [Source:UniProtKB/Swiss-Prot;Acc:Q96FH0]
Mouse Orthologue:
2310045N01Rik
Mouse Description:
RIKEN cDNA 2310045N01 gene Gene [Source:MGI Symbol;Acc:MGI:1919618]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24144 Nonsense Mutation detected in F1 DNA During 2014
sa6703 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24144
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105432 Nonsense 107 124 4 6
Genomic Location:
Chromosome 22 (position 18392677)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTCCGGCAAGCCATTTCTCTGAAGGAACAGATCAGCAGCTCGCAGGGA[C/T]GAAGGTTGTAATCGCCGTCCATTTGTTTTTGCGCTTTTATAAAATCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6703
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105432 Nonsense 115 124 5 6
Genomic Location:
Chromosome 22 (position 18392837)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTGTTTTGAAATACGCATGTGGCTTCAGTGCTGTGATTAATCCAAAC[G/T]AAACACCCGCACACACTTCAGTCACACCTTGAATYATGGAAATCATTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rvwziyrf