ryr3

Ensembl ID:
ENSDARG00000071331
ZFIN ID:
ZDB-GENE-041001-165
Description:
Ryanodine receptor 3 [Source:UniProtKB/TrEMBL;Acc:A7M796]
Human Orthologue:
RYR3
Human Description:
ryanodine receptor 3 [Source:HGNC Symbol;Acc:10485]
Mouse Orthologue:
Ryr3
Mouse Description:
ryanodine receptor 3 Gene [Source:MGI Symbol;Acc:MGI:99684]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9447 Nonsense Available for shipment Available now
sa7471 Missense Mutation detected in F1 DNA During 2014
sa4098 Nonsense Mutation detected in F1 DNA During 2014
sa956 Essential Splice Site F2 line generated During 2014
sa4907 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9285 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9447
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077838 None None 409 None 10
ENSDART00000147464 Nonsense 516 4864 14 98
Genomic Location:
Chromosome 20 (position 29392620)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTTGTCCATTAGCCGCTTTGATCAAAGGCAACAGGACCAACTGCACA[C/T]AGTTCTCTCGCAAGCTGGATTGGCTAGTCAGCAAACTTGAGCGATTRGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7471
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077838 None None 409 None 10
ENSDART00000147464 Missense 699 4864 17 98
Genomic Location:
Chromosome 20 (position 29388795)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGGTGTTGGAGATGATCTTTACTCCTACGGTTTTGATGGCCTTCATCTG[T/C]GGGCAGGTACATTTWAGGGAATATTTCATCCAAATATGACATTTCTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4098
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077838 None None 409 None 10
ENSDART00000147464 Nonsense 1025 4864 24 98
Genomic Location:
Chromosome 20 (position 29380839)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAAAACCGACGAAATCCGCGCTTAGTGCCATATGCTTTATTAGATGAA[C/T]GAACAAAGAAATCGAATAGAGACAGTCTTCGGGAGGCCATCCGTACTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa956
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077838 None None 409 None 10
ENSDART00000147464 Essential Splice Site 3194 4864 63 98
Genomic Location:
Chromosome 20 (position 29329164)
KASP Assay ID:
554-0861.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTGTATGCCTTCTATCCAATGCTCATTCGTTATGTGGACAACAACAGG[T/C]ATTCATGCCTTCACAATGATGGGAACTGTTAAGCAATTCCTATTTCCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4907
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077838 Essential Splice Site 263 409 7 10
ENSDART00000147464 Essential Splice Site 4614 4864 91 98
Genomic Location:
Chromosome 20 (position 29300673)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGACACCAAGTACCACGTGTGGAAAATGGGGGTGGTGATGACGGATAAC[G/T]TGAGTCTGGCTTAGATATGATGTGAAAACATTAGAAAAATCATCATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9285
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077838 Essential Splice Site 357 409 9 10
ENSDART00000147464 Essential Splice Site 4708 4864 93 98
Genomic Location:
Chromosome 20 (position 29300218)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCGAGGATGAGGACGCGCCTGACATGAAGTGTGACGATATGATGACTG[T/A]GAGTTTTGYTWTGTGTTTTHAAGAGGCATTCATTTGTWTTTATTGTTGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a93q1unu