LOC561110

Ensembl ID:
ENSDARG00000071304
Human Orthologue:
TBC1D2
Human Description:
TBC1 domain family, member 2 [Source:HGNC Symbol;Acc:18026]
Mouse Orthologue:
Tbc1d2
Mouse Description:
TBC1 domain family, member 2 Gene [Source:MGI Symbol;Acc:MGI:2652885]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9303 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22419 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9303
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105344 Essential Splice Site 327 926 6 14
Genomic Location:
Chromosome 14 (position 6316913)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTCAGCATGAAAAACTTTCCCTGGCTGAAGAGGTCAAAGCTCAGAAGG[T/C]AAAGTGAGGACATTACACACCACTTCAKCTTYTTCTTCCTGTTGGTTTAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22419
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105344 Essential Splice Site 492 926 8 14
Genomic Location:
Chromosome 14 (position 6320990)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGCTTTGGAGAAAAAGTTCTGAACGGGAGAAAAGTCTTATAGTAAAGG[T/A]GAATTATTATTATTACATTCCTGGTACTACCATTTAGTCAAGCTAGTAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bbfntbe6