LOC100149598

Ensembl ID:
ENSDARG00000071298
Human Orthologue:
CHRM3
Human Description:
cholinergic receptor, muscarinic 3 [Source:HGNC Symbol;Acc:1952]
Mouse Orthologue:
Chrm3
Mouse Description:
cholinergic receptor, muscarinic 3, cardiac Gene [Source:MGI Symbol;Acc:MGI:88398]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35376 Nonsense Mutation detected in F1 DNA During 2017
sa30967 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35376
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105331 Nonsense 292 502 1 1
Genomic Location (Zv9):
Chromosome 12 (position 48725012)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 47432422
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAATGTGGAGGAAGAATCTGTGGTGGTCGTTCCTCAAACGGGAAGTTCT[C/T]GAAGTCACAGCAGCTACGAGCTCCAACCGGCAGCTCCGATGAGGAAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30967
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105331 Nonsense 368 502 1 1
Genomic Location (Zv9):
Chromosome 12 (position 48724784)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 47432650
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATCTACACAATCGAGAAGCAAGATTTAGAGGCGAAACCATCTAAATTC[G/T]GAGTTTCAAAATCATCCACTCTGGACTCCAAAGATCAACCTGTTAAATCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link