utrn

Ensembl ID:
ENSDARG00000071274
ZFIN ID:
ZDB-GENE-070228-6
Description:
Utrophin isoform G [Source:UniProtKB/TrEMBL;Acc:A2CKC9]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa918 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa918
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105287 None None 154 None 3
ENSDART00000131381 Essential Splice Site 227 250 6 6
ENSDART00000134991 None None 148 None 3
ENSDART00000145543 None None 291 None 6
Genomic Location:
Chromosome 23 (position 1248986)
KASP Assay ID:
554-0824.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGANTTTTAGTGGACGTCAGTATGAATGYGTGTTTGGGTGTGTTTTTC[A/T]GCTGTTGAGGCGAGAYGAGTGTGTGAGTGAAGGACAGGAGAAAGTGTCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ikhtfimr