ncoa6

Ensembl ID:
ENSDARG00000071272
ZFIN ID:
ZDB-GENE-080403-12
Description:
NcoA6 [Source:UniProtKB/TrEMBL;Acc:Q1L671]
Human Orthologue:
NCOA6
Human Description:
nuclear receptor coactivator 6 [Source:HGNC Symbol;Acc:15936]
Mouse Orthologue:
Ncoa6
Mouse Description:
nuclear receptor coactivator 6 Gene [Source:MGI Symbol;Acc:MGI:1929915]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37597 Nonsense Mutation detected in F1 DNA During 2017
sa12672 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37597
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105284   None 1168 None 5
ENSDART00000105286 Nonsense 362 1733 12 23
ENSDART00000137641   None 154 None 4
ENSDART00000147953 Nonsense 331 486 5 5

The following transcripts of ENSDARG00000071272 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 2724092)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2770572
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCTGGAGAAAAGCTCCACCACAGCCACAAATGGGGCAGCGTCCACCCT[C/A]GTTGGCGTCTGTCCAGACGCCCAATCATCCACCACCACCATACCCATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12672
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105284 Nonsense 190 1168 1 5
ENSDART00000105286 Nonsense 1101 1733 21 23
ENSDART00000137641   None 154 None 4
ENSDART00000147953   None 486 None 5

The following transcripts of ENSDARG00000071272 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 2727360)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2773840
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAGGACCGAGGACCCCCTGAAATTGGTCAACAATCAGGAAATGGAAAT[C/T]AGCCAATCATTTCCAACCAAGGTTCTAATACACATTTAATGAAATCTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link