POLR3A

Ensembl ID:
ENSDARG00000071269
Description:
polymerase (RNA) III (DNA directed) polypeptide A, 155kDa [Source:HGNC Symbol;Acc:30074]
Human Orthologue:
POLR3A
Human Description:
polymerase (RNA) III (DNA directed) polypeptide A, 155kDa [Source:HGNC Symbol;Acc:30074]
Mouse Orthologue:
Polr3a
Mouse Description:
polymerase (RNA) III (DNA directed) polypeptide A Gene [Source:MGI Symbol;Acc:MGI:2681836]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa907 Nonsense Available for shipment Available now
sa31896 Nonsense Available for shipment Available now
sa44776 Essential Splice Site Mutation detected in F1 DNA During 2018
sa38910 Nonsense Mutation detected in F1 DNA During 2018
sa35377 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa907
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105273 Nonsense 623 1390 14 31
Genomic Location (Zv9):
Chromosome 12 (position 49083172)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 47764835
GRCz11 12 47830388
KASP Assay ID:
554-0814.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCCAGTAAAAGCTGTCCGGTAATGGCCAACCTGCGCACCAAAGGCAAA[C/T]AATACTGCGGTAAAGGGGAGGATCTGTGTGCTAAYGACTCCTGTGAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31896
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105273 Nonsense 739 1390 16 31
Genomic Location (Zv9):
Chromosome 12 (position 49085150)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 47766813
GRCz11 12 47832366
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAATGTGATGAATACATTGATGCGCTGAAGACGGGACGCTTACAGCAG[C/T]AGCCGGGCTGCACCGCCGAGGAGACTCTCGAGGTTTACTCATGAAAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44776
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105273 Essential Splice Site 826 1390 18 31
Genomic Location (Zv9):
Chromosome 12 (position 49088228)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 47769891
GRCz11 12 47835444
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATGGCTTTGAGAACCGATCTCTGCCACACTTCCAGAAACACTCCAAAG[T/A]AAGCAGAAATACTGTGCGTTATCTGTGTGTGTGTGTGTGTGTGTGTTCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38910
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105273 Nonsense 917 1390 20 31
Genomic Location (Zv9):
Chromosome 12 (position 49091796)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 47773459
GRCz11 12 47839012
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCTACGGCGGAGACGGACTCGATCCTGCAGCCATGGAGGGAAAAGAC[G/T]AACCGCTTGAGTTCAAGAGAGTCCTCGACAACATACGAGTACGTCCATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35377
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105273 Nonsense 1026 1390 24 31
Genomic Location (Zv9):
Chromosome 12 (position 49100184)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 47781847
GRCz11 12 47847400
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGGAGTCATGTTATCAACTAAAGTCAGCTTGTTCTGGTTCTCAGGGCG[C/T]AGATGGAGCCCGGGTCTGCAGTCGGGGCTCTCTGTGCTCAGAGTATTGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link