MIPOL1

Ensembl ID:
ENSDARG00000071262
Description:
mirror-image polydactyly 1 [Source:HGNC Symbol;Acc:21460]
Human Orthologue:
MIPOL1
Human Description:
mirror-image polydactyly 1 [Source:HGNC Symbol;Acc:21460]
Mouse Orthologue:
Mipol1
Mouse Description:
mirror-image polydactyly gene 1 homolog (human) Gene [Source:MGI Symbol;Acc:MGI:1920740]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32126 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36335 Nonsense Mutation detected in F1 DNA During 2016
sa36336 Nonsense Mutation detected in F1 DNA During 2016
sa2915 Essential Splice Site F2 line generated During 2016

Mutation Details

Allele Name:
sa32126
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105266 Essential Splice Site 66 223 3 7
Genomic Location:
Chromosome 17 (position 10183443)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTCTCTCTCTTCCCCTCTCTCTCTCTCTCTCTTTTTTTTTTTCTCTC[A/T]GTGCTAGTGGAGGAAATCTATAAGGCTCAGAGGGAGAGAGACCAGGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36335
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105266 Nonsense 139 223 5 7
Genomic Location:
Chromosome 17 (position 10196015)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGGAGCTGTTGAACCGGGTGAACAGTGCAGAATCTGCCCTCGCTATT[G/T]AACAGAGCGGAGCGGCCATCATTGAACAGATCCAAAGGGCCAGAGAGCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36336
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105266 Nonsense 148 223 5 7
Genomic Location:
Chromosome 17 (position 10196042)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCAGAATCTGCCCTCGCTATTGAACAGAGCGGAGCGGCCATCATTGAA[C/T]AGATCCAAAGGGCCAGAGAGCGACGTTCCCAGATCACCTCAGAGGAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2915
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105266 Essential Splice Site 177 223 5 7
ENSDART00000105266 Essential Splice Site 177 223 5 7
Genomic Location:
Chromosome 17 (position 10196133)
KASP Assay ID:
554-3055.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGAGATGAAAACAGTCATCCARGAGCGAGACGCTGCTTTAACCAGGG[T/C]ACAAACCCACAGCACACACTCAAGGGTCAATCCTAACACACACCAGCCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link