ftr58

Ensembl ID:
ENSDARG00000071238
ZFIN IDs:
ZDB-GENE-080219-44, ZDB-GENE-080219-44
Description:
Zgc:172047 protein [Source:UniProtKB/TrEMBL;Acc:A8WFY9]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43912 Nonsense Mutation detected in F1 DNA During 2017
sa43911 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43912
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055085   None 241 2 6
ENSDART00000056426 Nonsense 254 542 3 6
Genomic Location (Zv9):
Chromosome 23 (position 6972665)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 6927202
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCTTTATTGAGATCATCCGCTACATTGAGAGACAATGCTCTGAGCTC[A/T]AGCAGATGATCAGAGATCAGCAAAAGACTGCTGTAAGGGATGCTGAAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43911
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055085 Essential Splice Site None 241 None 6
ENSDART00000056426 Essential Splice Site 373 542 None 6
Genomic Location (Zv9):
Chromosome 23 (position 6971634)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 6926171
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACACATTTACCAACACTGTTCCCGAGACCAGGAATGACTTCCTACAATG[T/A]AAGTTGCTAAGAAAATGAGCAGACAAACTCACTGAGTGTGTTTGTGTACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link