LOC100150452

Ensembl ID:
ENSDARG00000071235
Human Orthologues:
AC133561.1, SLC6A8
Human Description:
solute carrier family 6 (neurotransmitter transporter, creatine), member 8 [Source:HGNC Symbol;Acc:1
Mouse Orthologue:
Slc6a8
Mouse Description:
solute carrier family 6 (neurotransmitter transporter, creatine), member 8 Gene [Source:MGI Symbol;A

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39396 Essential Splice Site Mutation detected in F1 DNA During 2016
sa29874 Nonsense Mutation detected in F1 DNA During 2016
sa24253 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39396
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092131 Essential Splice Site 142 652 3 14
Genomic Location:
Chromosome 23 (position 6920011)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGAAACAGGGAGGGGTCGCCACATGGAACATTGCGCCTCTTTTCAAAG[G/A]TAAAGTATTCTTTACAGTTAAATGTATTTGAACACACTCAAACTCTTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29874
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092131 Nonsense 225 652 4 14
Genomic Location:
Chromosome 23 (position 6921239)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACAACTCCTCCCTCAACATCAGTGCCGGCTGCCTTGAGCCCACGGGTT[T/A]GCGATCATCTGTTATGGAATTCTGGGAGTAAGTGCCTTTAAAATCCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24253
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092131 Essential Splice Site 552 652 12 14
Genomic Location:
Chromosome 23 (position 6949165)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCGTATATGAAGTGGTGCTGGTCCTACATCACGCCGGTAGTGTGTATG[G/T]TGAGGTTTCCATAATAATACTCTAAACACGAGGTTTCATATTAAGTAGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link