si:ch211-175l6.3

Ensembl ID:
ENSDARG00000071225
ZFIN ID:
ZDB-GENE-060503-201
Description:
hypothetical protein LOC561381 [Source:RefSeq peptide;Acc:NP_001038423]
Human Orthologue:
TRIM35
Human Description:
tripartite motif-containing 35 [Source:HGNC Symbol;Acc:16285]
Mouse Orthologue:
Trim35
Mouse Description:
tripartite motif-containing 35 Gene [Source:MGI Symbol;Acc:MGI:1914104]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7266 Nonsense Mutation detected in F1 DNA During 2017
sa39993 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7266
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040967 Nonsense 37 290 1 5
ENSDART00000141995 Nonsense 37 451 1 6
Genomic Location (Zv9):
Chromosome 3 (position 8117680)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8087922
KASP Assay ID:
554-4443.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAATCCTGTAGTTTTATCATGCAGTCACAGYGTGTGTAAAGAGTGTCTT[C/T]ARCAGTTCTGGGGAACCAAGAATACTCARGAGTGTCCTGTTTGCCGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39993
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040967 Nonsense 203 290 3 5
ENSDART00000141995 Nonsense 203 451 3 6
Genomic Location (Zv9):
Chromosome 3 (position 8124377)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8081225
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGAGATGAAGAAGAAGCTACAATCACTGCACTAAGAGAGGAAGAGGAG[C/T]AGAAGAAGCAGATGATGAAGGAGAAGCTGGAGGAGATGAACACACACATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link