si:ch211-133n4.4

Ensembl ID:
ENSDARG00000071224
ZFIN ID:
ZDB-GENE-030131-898
Description:
hypothetical protein LOC559260 [Source:RefSeq peptide;Acc:NP_001070844]
Human Orthologue:
ENDOD1
Human Description:
endonuclease domain containing 1 [Source:HGNC Symbol;Acc:29129]
Mouse Orthologue:
Endod1
Mouse Description:
endonuclease domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1919196]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32229 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32229
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105168 Nonsense 250 266 2 2

The following transcripts of ENSDARG00000071224 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 3801078)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3297651
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACAGCTGCGTTTAACGGCGAAAGCCTGGCTGCACTACAGAATTTTCTG[A/T]AGGAAAAATTAAAGAAAAATAATGTACAGCTATTTTCGAACAAATGTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link