A4QP96_DANRE

Ensembl ID:
ENSDARG00000071213
Description:
LOC100149956 protein [Source:UniProtKB/TrEMBL;Acc:A4QP96]
Human Orthologue:
RGL3
Human Description:
ral guanine nucleotide dissociation stimulator-like 3 [Source:HGNC Symbol;Acc:30282]
Mouse Orthologue:
Rgl3
Mouse Description:
ral guanine nucleotide dissociation stimulator-like 3 Gene [Source:MGI Symbol;Acc:MGI:1918996]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25329 Nonsense Mutation detected in F1 DNA During 2016
sa10827 Essential Splice Site Available for shipment Available now
sa33813 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa25329
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122796 Nonsense 227 782 5 17
Genomic Location (Zv9):
Chromosome 6 (position 9570906)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 7989756
KASP Assay ID:
554-7720.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACACACACAAACAGCTCTAAATAACTCCTTATGAATCAACAGACAAG[C/T]AAATATGTACATCAGCAGAGGTCAATGCCTCTGCTGTTGAGAATCCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10827
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122796 Essential Splice Site 276 782 5 17
Genomic Location (Zv9):
Chromosome 6 (position 9571056)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 7989606
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACTTCCCTGCACAGGACATTGCCGAGCAGCTTACAATATTAGACGCA[G/A]TAGGTGTCAAGATTTACACAATCAAGCTANGTTTTAATTAAATGCCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33813
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122796 Essential Splice Site 733 782 16 17
Genomic Location (Zv9):
Chromosome 6 (position 9584035)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 7976627
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGAACTGCCAAGATTTTACTCTCACACAGGTGCTTTCTAACGACAAAG[G/A]TGAGCTTCTTGATCTGTACAGATTTTTTAAAATGAATTATTTTTTTATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link