A4QP96_DANRE

Ensembl ID:
ENSDARG00000071213
Description:
LOC100149956 protein [Source:UniProtKB/TrEMBL;Acc:A4QP96]
Human Orthologue:
RGL3
Human Description:
ral guanine nucleotide dissociation stimulator-like 3 [Source:HGNC Symbol;Acc:30282]
Mouse Orthologue:
Rgl3
Mouse Description:
ral guanine nucleotide dissociation stimulator-like 3 Gene [Source:MGI Symbol;Acc:MGI:1918996]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25329 Nonsense Mutation detected in F1 DNA During 2014
sa10827 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa25329
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122796 Nonsense 227 782 5 17
Genomic Location:
Chromosome 6 (position 9570906)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACACACACAAACAGCTCTAAATAACTCCTTATGAATCAACAGACAAG[C/T]AAATATGTACATCAGCAGAGGTCAATGCCTCTGCTGTTGAGAATCCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10827
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122796 Essential Splice Site 276 782 5 17
Genomic Location:
Chromosome 6 (position 9571056)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACTTCCCTGCACAGGACATTGCCGAGCAGCTTACAATATTAGACGCA[G/A]TAGGTGTCAAGATTTACACAATCAAGCTANGTTTTAATTAAATGCCTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pat05c8k