oprl1

Ensembl ID:
ENSDARG00000071209
ZFIN ID:
ZDB-GENE-040312-4
Description:
nociceptin receptor [Source:RefSeq peptide;Acc:NP_991152]
Human Orthologue:
OPRL1
Human Description:
opiate receptor-like 1 [Source:HGNC Symbol;Acc:8155]
Mouse Orthologue:
Oprl1
Mouse Description:
opioid receptor-like 1 Gene [Source:MGI Symbol;Acc:MGI:97440]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37616 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37616
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105135 Nonsense 40 363 2 4
Genomic Location (Zv9):
Chromosome 23 (position 8462478)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 8448189
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTCCAGAACAACTTCAGCACCTTCAATGAGAGTGACAGCTTCTTCCCC[A/T]AAGGCTTTAAGATCACTATAGCTGTGGTGTACATGATTGTCTGCGTGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link