usp40

Ensembl ID:
ENSDARG00000071197
ZFIN ID:
ZDB-GENE-060518-5
Description:
Ubiquitin carboxyl-terminal hydrolase [Source:UniProtKB/TrEMBL;Acc:Q7SYB6]
Human Orthologue:
USP40
Human Description:
ubiquitin specific peptidase 40 [Source:HGNC Symbol;Acc:20069]
Mouse Orthologue:
Usp40
Mouse Description:
ubiquitin specific peptidase 40 Gene [Source:MGI Symbol;Acc:MGI:2443184]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20639 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20638 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20637 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20639
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105098 Essential Splice Site 179 1263 4 31
Genomic Location:
Chromosome 6 (position 9138487)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTCAACCAGATTACCTGCAAGGAGTGCAGCTATATTAGCGAGAGACAG[G/A]TCAGAACAGAGCTGTATTTTGATCTCAGCTATACAATTTTAAAAACACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20638
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105098 Essential Splice Site 179 1263 4 31
Genomic Location:
Chromosome 6 (position 9138486)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCAACCAGATTACCTGCAAGGAGTGCAGCTATATTAGCGAGAGACAGG[T/C]CAGAACAGAGCTGTATTTTGATCTCAGCTATACAATTTTAAAAACACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20637
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105098 Nonsense 935 1263 22 31
Genomic Location:
Chromosome 6 (position 9121271)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTTCTTTCTAAAGGTGAATCGTGGCACTTGAGGAGAGTAGACTGGTG[T/A]GAGGAGATTGGAGAACCACTTATGGATGAGGTGAGAGATTGTAATATAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bilirubin levels: Mayo Genome Consortia: a genotype-phenotype resource for genome-wide association studies with an application to the analysis of circulating bilirubin levels. (View Study)
  • Crohn's disease: A genome-wide scan of Ashkenazi Jewish Crohn's disease suggests novel susceptibility loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ilqqgjlk