LOC565638

Ensembl ID:
ENSDARG00000071192
Human Orthologue:
GJA1
Human Description:
gap junction protein, alpha 1, 43kDa [Source:HGNC Symbol;Acc:4274]
Mouse Orthologues:
Gja1, Gja6
Mouse Descriptions:
gap junction protein, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:95713]
gap junction protein, alpha 6 Gene [Source:MGI Symbol;Acc:MGI:95717]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32140 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32140
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105086 Nonsense 263 354 1 1
Genomic Location (Zv9):
Chromosome 17 (position 15257905)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15408733
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGACAGTGCCTGCAATATCAAGCCCTGTCCGAGGAATCTGTCCGGCTA[T/G]GAGTATTACAATGACTGCTCGGCCCCCGTCCCAAATCTAGGCTACAATCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link