si:ch211-39e15.1

Ensembl ID:
ENSDARG00000071150
ZFIN ID:
ZDB-GENE-060503-700
Description:
Novel protein similar to vertebrate capicua homolog (Drosophila) (CIC) [Source:UniProtKB/TrEMBL;Acc:
Human Orthologue:
CIC
Human Description:
capicua homolog (Drosophila) [Source:HGNC Symbol;Acc:14214]
Mouse Orthologue:
Cic
Mouse Description:
capicua homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1918972]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12496 Nonsense Available for shipment Available now
sa43212 Essential Splice Site Mutation detected in F1 DNA During 2017
sa1539 Nonsense F2 line generated During 2017
sa39226 Essential Splice Site Mutation detected in F1 DNA During 2017
sa13191 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12496
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104978 Nonsense 295 2440 1 19
ENSDART00000140051   None 1323 None 18
Genomic Location (Zv9):
Chromosome 19 (position 6749981)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 6208656
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAATCAGAGAGTTTTGGCCCGACAGGGTCCTAGATTAGGRGAAGGCTG[G/A]CCTCATGATCGTGGCCGGGATGTATCAGGAGTGTTTCGCACTGGTGTCRT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43212
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104978 Essential Splice Site 1360 2440 6 19
ENSDART00000140051 Essential Splice Site 191 1323 5 18
Genomic Location (Zv9):
Chromosome 19 (position 6739199)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 6197874
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTTCATCGCATAACTCTATCATTAACCATTAAATTTCACACTCTTGT[A/G]GGTGAAGGAGGCTCATTTCCGGGCTCACCCTGATTGGAAATGGTGTAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1539
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104978 Nonsense 1378 2440 6 19
ENSDART00000140051 Nonsense 209 1323 5 18
Genomic Location (Zv9):
Chromosome 19 (position 6739143)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 6197818
KASP Assay ID:
554-1462.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGGCTCATTTCCGGGCTCACCCTGATTGGAAATGGTGTAACAAGGAC[C/T]GAAGGAAGTCCCTGTCTGAGGGCCGGGGAACTCCAGGGGCCAAAGATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39226
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104978 Essential Splice Site 1862 2440 10 19
ENSDART00000140051 Essential Splice Site 745 1323 9 18
Genomic Location (Zv9):
Chromosome 19 (position 6727701)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 6186376
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTGGTGGGCCCGCCTCTTCCTGTTCAAAACGGTGCTCCAGGAAGTAAG[G/T]TACGTTGCCTAGTGTTACTATCTAACTCTATTAACAACACCTATACAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13191
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104978 Essential Splice Site 2311 2440 18 19
ENSDART00000140051 Essential Splice Site 1194 1323 17 18
Genomic Location (Zv9):
Chromosome 19 (position 6712819)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 6171494
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTAACCCATACATGAACATRAATGCATTTGRGTCTTCTGTGTTCATCA[G/A]TTGGAGAGACCGAGCATATTTTRGAAGAGCTGGAYCGCGTGCCGCCSTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link