LOC100151335

Ensembl ID:
ENSDARG00000071139
Human Orthologue:
PLCXD1
Human Description:
phosphatidylinositol-specific phospholipase C, X domain containing 1 [Source:HGNC Symbol;Acc:23148]
Mouse Orthologue:
Plcxd1
Mouse Description:
phosphatidylinositol-specific phospholipase C, X domain containing 1 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7026 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20633 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7026
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104965 Essential Splice Site 114 302 3 6
Genomic Location:
Chromosome 6 (position 8649446)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGCGATTTCTTCTTCTATCATGGATTGTACACAACGATGACTGTGAAG[G/A]TTGTTGACCTGATTCAGTTTTTTGTTATTTAAATKAATTGAATTCAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20633
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104965 Essential Splice Site 114 302 3 6
Genomic Location:
Chromosome 6 (position 8649445)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCGATTTCTTCTTCTATCATGGATTGTACACAACGATGACTGTGAAGG[T/C]TGTTGACCTGATTCAGTTTTTTGTTATTTAAATTAATTGAATTCAACAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m4aro6m2