LOC100151335

Ensembl ID:
ENSDARG00000071139
Human Orthologue:
PLCXD1
Human Description:
phosphatidylinositol-specific phospholipase C, X domain containing 1 [Source:HGNC Symbol;Acc:23148]
Mouse Orthologue:
Plcxd1
Mouse Description:
phosphatidylinositol-specific phospholipase C, X domain containing 1 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7026 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20633 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa7026
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104965 Essential Splice Site 114 302 3 6
Genomic Location (Zv9):
Chromosome 6 (position 8649446)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 8910841
KASP Assay ID:
554-5108.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGCGATTTCTTCTTCTATCATGGATTGTACACAACGATGACTGTGAAG[G/A]TTGTTGACCTGATTCAGTTTTTTGTTATTTAAATKAATTGAATTCAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20633
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104965 Essential Splice Site 114 302 3 6
Genomic Location (Zv9):
Chromosome 6 (position 8649445)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 8910842
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCGATTTCTTCTTCTATCATGGATTGTACACAACGATGACTGTGAAGG[T/C]TGTTGACCTGATTCAGTTTTTTGTTATTTAAATTAATTGAATTCAACAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link