xirp2a

Ensembl ID:
ENSDARG00000071113
ZFIN ID:
ZDB-GENE-040108-7
Description:
LOC559746 protein [Source:UniProtKB/TrEMBL;Acc:Q4V9G7]
Human Orthologue:
LIMA1
Human Description:
LIM domain and actin binding 1 [Source:HGNC Symbol;Acc:24636]
Mouse Orthologue:
Lima1
Mouse Description:
LIM domain and actin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1920992]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12933 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12933
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104928 Nonsense 36 263 3 3
Genomic Location:
Chromosome 6 (position 10083884)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTGTATCTCTTTGCTATAGTCTTGGAACCTATGCTTCTCTCCATGGA[C/T]GAATGTACTGTAAGCCACATTATAAACAACTTTTCAAGTCTAAAGGCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/eutkw0da