actn2

Ensembl ID:
ENSDARG00000071090
ZFIN ID:
ZDB-GENE-051127-39
Description:
alpha-actinin-2 [Source:RefSeq peptide;Acc:NP_001032662]
Human Orthologue:
ACTN2
Human Description:
actinin, alpha 2 [Source:HGNC Symbol;Acc:164]
Mouse Orthologue:
Actn2
Mouse Description:
actinin alpha 2 Gene [Source:MGI Symbol;Acc:MGI:109192]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7828 Nonsense Mutation detected in F1 DNA During 2016
sa42906 Nonsense Mutation detected in F1 DNA During 2016
sa274 Nonsense, Stop Lost Confirmed mutation in F2 line During 2016
sa36380 Nonsense Mutation detected in F1 DNA During 2016
sa36379 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa7828
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104882 Nonsense 43 895 1 21
ENSDART00000133327 Nonsense 42 126 1 16
ENSDART00000138911 Nonsense 42 894 1 21
Genomic Location:
Chromosome 17 (position 19973791)
KASP Assay ID:
2261-0883.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGGGACCGGGATTTACTGCTGGATCCWGCATGGGAAAAGCAACAAAGG[A/T]AGGTAAAGAGAGTTTGGCCTTCACTGAATAAAAACTTTAYTTCTATTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42906
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104882 Nonsense 213 895 7 21
ENSDART00000133327   None 126 None 16
ENSDART00000138911 Nonsense 212 894 7 21
Genomic Location:
Chromosome 17 (position 19964856)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTGTGCCCGTTCCTCTCCTTTCCTGTAGGATGATCCACTGGGTAATT[T/A]AAATCTGGCATTTGACATTGCTGAAAAACATCTGGACATCCCCAAAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa274
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense, Stop Lost
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104882 Nonsense 287 895 9 21
ENSDART00000133327 Stop Lost 127 126 4 16
ENSDART00000138911 Nonsense 286 894 9 21
Genomic Location:
Chromosome 17 (position 19963205)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAAGGTGCTTGGAGTGAATCAGGAAAATGAGAAGTTGATGGAGGATTA[T/A]GAAAGGCTGGCTAGTGAGGTGAGAAGACACATTGTAGTCTAATACATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36380
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104882 Nonsense 681 895 17 21
ENSDART00000133327   None 126 12 16
ENSDART00000138911 Nonsense 680 894 17 21
Genomic Location:
Chromosome 17 (position 19957340)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCTATGGCGATGGGCGGAACTCTGGAGGATCAGATGACCCAACTGAAG[C/T]AGTATGAGCATGTGATCGTCAGCTACAAATCCAACATAGACCGACTTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36379
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104882 Nonsense 682 895 17 21
ENSDART00000133327   None 126 12 16
ENSDART00000138911 Nonsense 681 894 17 21
Genomic Location:
Chromosome 17 (position 19957335)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGCGATGGGCGGAACTCTGGAGGATCAGATGACCCAACTGAAGCAGTA[T/A]GAGCATGTGATCGTCAGCTACAAATCCAACATAGACCGACTTGAGGGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link