actn2

Ensembl ID:
ENSDARG00000071090
ZFIN ID:
ZDB-GENE-051127-39
Description:
alpha-actinin-2 [Source:RefSeq peptide;Acc:NP_001032662]
Human Orthologue:
ACTN2
Human Description:
actinin, alpha 2 [Source:HGNC Symbol;Acc:164]
Mouse Orthologue:
Actn2
Mouse Description:
actinin alpha 2 Gene [Source:MGI Symbol;Acc:MGI:109192]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7828 Nonsense Mutation detected in F1 DNA During 2014
sa274 Nonsense, Stop Lost Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa7828
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104882 Nonsense 43 895 1 21
ENSDART00000133327 Nonsense 42 126 1 16
ENSDART00000138911 Nonsense 42 894 1 21
Genomic Location:
Chromosome 17 (position 19973791)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGGGACCGGGATTTACTGCTGGATCCWGCATGGGAAAAGCAACAAAGG[A/T]AGGTAAAGAGAGTTTGGCCTTCACTGAATAAAAACTTTAYTTCTATTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa274
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense, Stop Lost
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104882 Nonsense 287 895 9 21
ENSDART00000133327 Stop Lost 127 126 4 16
ENSDART00000138911 Nonsense 286 894 9 21
Genomic Location:
Chromosome 17 (position 19963205)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAAGGTGCTTGGAGTGAATCAGGAAAATGAGAAGTTGATGGAGGATTA[T/A]GAAAGGCTGGCTAGTGAGGTGAGAAGACACATTGTAGTCTAATACATATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v50qwz77