si:ch73-162i18.1

Ensembl ID:
ENSDARG00000071088
ZFIN ID:
ZDB-GENE-060503-894
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1L866]
Human Orthologue:
GPR128
Human Description:
G protein-coupled receptor 128 [Source:HGNC Symbol;Acc:19241]
Mouse Orthologue:
Gpr128
Mouse Description:
G protein-coupled receptor 128 Gene [Source:MGI Symbol;Acc:MGI:2441732]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37539 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32406 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37539
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089330 Essential Splice Site 21 421 1 9
ENSDART00000146969   None 187 None 4
Genomic Location (Zv9):
Chromosome 22 (position 29982123)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 28644904
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTTTCAAAGATGTAATAGACCTTCAAATGAACATCGCATTTAATCAAG[G/A]CAAGGCTTAATTTTGACTTTTTTCTTTACTTAATTTGGGAGGCATTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32406
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089330 Nonsense 359 421 8 9
ENSDART00000146969 Nonsense 83 187 3 4
Genomic Location (Zv9):
Chromosome 22 (position 29988396)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 28638631
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATAAAAGAAAAAACATTTCAAAGATAAACCTCTTCCTATGTGTAGGTCA[C/T]GAAAAACCCCTCTAAAGAATAAGATTTTGAGTAGTTTCTCTCTGGCAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link