LOC100005567

Ensembl ID:
ENSDARG00000071086
Human Orthologue:
GPR155
Human Description:
G protein-coupled receptor 155 [Source:HGNC Symbol;Acc:22951]
Mouse Orthologue:
Gpr155
Mouse Description:
G protein-coupled receptor 155 Gene [Source:MGI Symbol;Acc:MGI:1915776]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2324 Essential Splice Site F2 line generated During 2014
sa20658 Nonsense Mutation detected in F1 DNA During 2014
sa25331 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2324
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104885 Essential Splice Site 200 749 3 16
Genomic Location:
Chromosome 6 (position 10681479)
KASP Assay ID:
554-3329.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GRAAGTTAACTCTATTTTCTGCYTTTTTTAAATCCTTTTCCTCTGTTTTC[A/C]GGTTTTGAAGAACCCAATAGTCTTCATGGTKATGGTTGGRATTGTCTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20658
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104885 Nonsense 545 749 10 16
Genomic Location:
Chromosome 6 (position 10674908)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGATTGAGTCGGGGGGCTCAGGAGGAGCAGAGTTATCAGGCCTTAGAT[C/T]AAAACTCCATCACAGGTGCATCAGAAAATTCCAGACACCTCCAGACAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25331
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104885 Nonsense 650 749 13 16
Genomic Location:
Chromosome 6 (position 10670168)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGAACCTGTCCAGCTGCCTGTGGTGGTTGTTCAGTGCTGATCCAGGA[C/T]GACTTTACCTCGAGCTGCAGTTTTTTTGCGCTGTAGCCAATTATGGACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j1acwpbb