LOC100005567

Ensembl ID:
ENSDARG00000071086
Human Orthologue:
GPR155
Human Description:
G protein-coupled receptor 155 [Source:HGNC Symbol;Acc:22951]
Mouse Orthologue:
Gpr155
Mouse Description:
G protein-coupled receptor 155 Gene [Source:MGI Symbol;Acc:MGI:1915776]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2324 Essential Splice Site F2 line generated During 2016
sa20658 Nonsense Available for shipment Available now
sa25331 Nonsense Mutation detected in F1 DNA During 2016
sa33820 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa2324
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104885 Essential Splice Site 200 749 3 16
Genomic Location (Zv9):
Chromosome 6 (position 10681479)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10535105
KASP Assay ID:
554-3329.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GRAAGTTAACTCTATTTTCTGCYTTTTTTAAATCCTTTTCCTCTGTTTTC[A/C]GGTTTTGAAGAACCCAATAGTCTTCATGGTKATGGTTGGRATTGTCTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20658
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104885 Nonsense 545 749 10 16
Genomic Location (Zv9):
Chromosome 6 (position 10674908)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10528534
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGATTGAGTCGGGGGGCTCAGGAGGAGCAGAGTTATCAGGCCTTAGAT[C/T]AAAACTCCATCACAGGTGCATCAGAAAATTCCAGACACCTCCAGACAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25331
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104885 Nonsense 650 749 13 16
Genomic Location (Zv9):
Chromosome 6 (position 10670168)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10523794
KASP Assay ID:
554-7779.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGAACCTGTCCAGCTGCCTGTGGTGGTTGTTCAGTGCTGATCCAGGA[C/T]GACTTTACCTCGAGCTGCAGTTTTTTTGCGCTGTAGCCAATTATGGACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33820
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104885 Nonsense 659 749 13 16
Genomic Location (Zv9):
Chromosome 6 (position 10670139)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10523765
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTCAGTGCTGATCCAGGACGACTTTACCTCGAGCTGCAGTTTTTTTG[C/A]GCTGTAGCCAATTATGGACAGGTGAACACGTCTCATTGTAGATGCATATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link