si:ch73-162i18.2

Ensembl ID:
ENSDARG00000071085
ZFIN ID:
ZDB-GENE-060503-46
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1L865]
Human Orthologue:
GPR128
Human Description:
G protein-coupled receptor 128 [Source:HGNC Symbol;Acc:19241]
Mouse Orthologue:
Gpr128
Mouse Description:
G protein-coupled receptor 128 Gene [Source:MGI Symbol;Acc:MGI:2441732]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37538 Essential Splice Site Mutation detected in F1 DNA During 2017
sa16563 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37538
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104886 Essential Splice Site 92 345 2 7
ENSDART00000145595   None 160 None 4
Genomic Location (Zv9):
Chromosome 22 (position 29961787)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 28665240
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATCCATTGTGGGCTTGGTCCTTACAACAATGTATCAAATTAAAACAAG[G/A]TACGTTCAAAAAAAGAACATGAATACATTTTAAATATATATGAGCATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16563
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104886 Essential Splice Site 282 345 6 7
ENSDART00000145595 Essential Splice Site 91 160 3 4
Genomic Location (Zv9):
Chromosome 22 (position 29965965)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 28661062
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTATCTATCTATCTATCTTTTTTGGTTAAATGTTGATTTCATTTCTGT[A/G]GCTCACGAAGAACTCCTTTAAAGAAGAAGATTTTGAGTAGTTTCTCTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link