LOC100151491

Ensembl ID:
ENSDARG00000071084
Human Orthologues:
AC092898.1, WIPF1
Human Description:
WAS/WASL interacting protein family, member 1 [Source:HGNC Symbol;Acc:12736]
Mouse Orthologue:
Wipf1
Mouse Description:
WAS/WASL interacting protein family, member 1 Gene [Source:MGI Symbol;Acc:MGI:2178801]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31500 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31500
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104884 Nonsense 295 461 5 9
Genomic Location (Zv9):
Chromosome 6 (position 10698844)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10552470
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGCCGCCAGGTCGCCCAAGCCCAAATACTCCAGATGAACATACGCCA[C/T]GACTTCCTGAACGAAACCTGTCACTAGCCTCACATCCGCCCGCACCTCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link