p4ha1

Ensembl ID:
ENSDARG00000071082
ZFIN ID:
ZDB-GENE-030131-4089
Description:
procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha 1 polypeptide [Sou
Human Orthologue:
P4HA1
Human Description:
prolyl 4-hydroxylase, alpha polypeptide I [Source:HGNC Symbol;Acc:8546]
Mouse Orthologue:
P4ha1
Mouse Description:
procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha 1 polypeptide Gene

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10102 Essential Splice Site Available for shipment Available now
sa14912 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10102
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104874 Essential Splice Site 25 536 2 15
Genomic Location (Zv9):
Chromosome 17 (position 19994582)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 20144593
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCCTCTTCCACTTCCTGTATGCCCACAATGACTTTTTCACTTCCACAG[G/A]TGAGACRAGCTTCYGTTGTTTTTGTTGYAGACTGTAKTTATATWTTWTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14912
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104874 Nonsense 391 536 10 15
Genomic Location (Zv9):
Chromosome 17 (position 19980028)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 20130039
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAYCATTCTATCTGTTTCTCCCTCATTCTAGCGCTTGGCTGTCTGGATA[T/G]GAACATTCTACCATTGAAAGGATTAACCAGCGTATTGAGGATGTAACAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link