naa10

Ensembl ID:
ENSDARG00000071060
ZFIN ID:
ZDB-GENE-040426-2648
Description:
N-alpha-acetyltransferase 10, NatA catalytic subunit [Source:RefSeq peptide;Acc:NP_998499]
Human Orthologues:
NAA10, NAA11
Human Descriptions:
N(alpha)-acetyltransferase 10, NatA catalytic subunit [Source:HGNC Symbol;Acc:18704]
N(alpha)-acetyltransferase 11, NatA catalytic subunit [Source:HGNC Symbol;Acc:28125]
Mouse Orthologues:
Gm16286, Naa10, Naa11
Mouse Descriptions:
N(alpha)-acetyltransferase 10, NatA catalytic subunitNalpha acetyltransferase 10 Gene [Source:MGI Sy
N(alpha)-acetyltransferase 11, NatA catalytic subunit Gene [Source:MGI Symbol;Acc:MGI:2141314]
predicted gene 16286 Gene [Source:MGI Symbol;Acc:MGI:3833940]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24271 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24271
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104831 Nonsense 145 224 7 8
Genomic Location (Zv9):
Chromosome 23 (position 13945389)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 14077322
KASP Assay ID:
2261-7444.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGATTAGCGAAGTGGAACCCAAATATTATGCCGATGGGGAAGATGCTTA[C/A]GCCATGAAGAGAAATCTCACGCAGATGGCAGATGAGGTATGTGCTGGTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link