si:dkey-150i13.2

Ensembl ID:
ENSDARG00000071052
ZFIN ID:
ZDB-GENE-090312-157
Human Orthologue:
SLC25A20
Human Description:
solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 [Source:HGNC Symbol;Acc:14
Mouse Orthologue:
Slc25a20
Mouse Description:
solute carrier family 25 (mitochondrial carnitine/acylcarnitine translocase), member 20 Gene [Source

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa29889 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29889
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104815 Essential Splice Site 175 296 6 9
ENSDART00000144268 Essential Splice Site 175 294 6 9

The following transcripts of ENSDARG00000071052 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 13037076)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 13169009
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAATTGAATTGATAAATGCTAACATCTATTTTCTTTTTGAGTTATTTA[G/T]ATGTGCCCTCAAATGGTGTATACTTTCTAACATATGACTACTTAAAACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link