si:ch211-8c17.4

Ensembl ID:
ENSDARG00000071050
ZFIN ID:
ZDB-GENE-091204-107

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33101 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33101
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104808 Splice Site None 653 None 10
ENSDART00000142037 Essential Splice Site 214 233 5 6
Genomic Location (Zv9):
Chromosome 3 (position 12417022)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12698627
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTATAAAACAGACATGAGCAACAAACAGCCACTGTGGGTCACTGGTGA[G/A]TTTACACAGAACTGAAATGATTGGATCATATTTCATGAAGAAAAAAGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link