si:dkey-119m7.4

Ensembl ID:
ENSDARG00000071049
ZFIN ID:
ZDB-GENE-040724-70
Description:
hypothetical protein LOC560629 [Source:RefSeq peptide;Acc:NP_001038399]
Human Orthologues:
SLC22A10, SLC22A11, SLC22A12, SLC22A24, SLC22A25, SLC22A6, SLC22A7, SLC22A8, SLC22A9
Human Descriptions:
solute carrier family 22 (organic anion transporter), member 6 [Source:HGNC Symbol;Acc:10970]
solute carrier family 22 (organic anion transporter), member 7 [Source:HGNC Symbol;Acc:10971]
solute carrier family 22 (organic anion transporter), member 8 [Source:HGNC Symbol;Acc:10972]
solute carrier family 22 (organic anion transporter), member 9 [Source:HGNC Symbol;Acc:16261]
solute carrier family 22 (organic anion/urate transporter), member 11 [Source:HGNC Symbol;Acc:18120]
solute carrier family 22 (organic anion/urate transporter), member 12 [Source:HGNC Symbol;Acc:17989]
solute carrier family 22, member 10 [Source:HGNC Symbol;Acc:18057]
solute carrier family 22, member 24 [Source:HGNC Symbol;Acc:28542]
solute carrier family 22, member 25 [Source:HGNC Symbol;Acc:32935]
Mouse Orthologues:
AB056442, BC014805, BC026439, C730048C13Rik, D630002G06Rik, Gm5631, Slc22a12, Slc22a19, Slc22a20, Slc22a6, Slc22a7, Slc22a8
Mouse Descriptions:
cDNA sequence AB056442 Gene [Source:MGI Symbol;Acc:MGI:3042283]
cDNA sequence BC014805 Gene [Source:MGI Symbol;Acc:MGI:2385316]
cDNA sequence BC026439 Gene [Source:MGI Symbol;Acc:MGI:2446114]
predicted gene 5631 Gene [Source:MGI Symbol;Acc:MGI:3645714]
RIKEN cDNA C730048C13 gene Gene [Source:MGI Symbol;Acc:MGI:2442750]
RIKEN cDNA D630002G06 gene Gene [Source:MGI Symbol;Acc:MGI:3605624]
solute carrier family 22 (organic anion transporter), member 19 Gene [Source:MGI Symbol;Acc:MGI:2442
solute carrier family 22 (organic anion transporter), member 20 Gene [Source:MGI Symbol;Acc:MGI:2685
solute carrier family 22 (organic anion transporter), member 6 Gene [Source:MGI Symbol;Acc:MGI:89200
solute carrier family 22 (organic anion transporter), member 7 Gene [Source:MGI Symbol;Acc:MGI:18595
solute carrier family 22 (organic anion transporter), member 8 Gene [Source:MGI Symbol;Acc:MGI:13361
solute carrier family 22 (organic anion/cation transporter), member 12 Gene [Source:MGI Symbol;Acc:M

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10047 Nonsense Available for shipment Available now
sa3051 Essential Splice Site F2 line generated During 2017
sa9186 Nonsense Mutation detected in F1 DNA During 2017
sa1625 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10047
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104807 Nonsense 18 413 1 7
ENSDART00000129429 Nonsense 18 542 1 10
Genomic Location (Zv9):
Chromosome 20 (position 325947)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 316542
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAACTTTGACAAGGTCCTGGACCGGATTGGTGGGTTTGGACGTTTTCAG[A/T]AGACTCTTTATGTTTGGATCTGTCTGCCACAGAWCTTTTTGGCCTTCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3051
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104807 Essential Splice Site 120 413 1 7
ENSDART00000129429 Essential Splice Site 120 542 1 10
Genomic Location (Zv9):
Chromosome 20 (position 326256)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 316851
KASP Assay ID:
554-2543.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGATGGGAGTTCAGCAAGGAGGTCTTCCTCAGCACTATCGCCACAGAG[G/A]TGAGTGCCCTCAAAAYATAGCAGTTGTGTAGCAGGATGTGTCGGTGATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9186
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104807 Nonsense 138 413 2 7
ENSDART00000129429 Nonsense 138 542 2 10
Genomic Location (Zv9):
Chromosome 20 (position 329169)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 319764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCTCGTGTGTGAAAACGCCACTATGAACAACATTGGCTCTTCTATCTA[T/A]ATGTTTGGGCTGCTGGTTGGAGCGGTGCTGTTCGGAGCCCTTGCTGATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1625
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104807 Nonsense 319 413 6 7
ENSDART00000129429 Nonsense 319 542 6 10
Genomic Location (Zv9):
Chromosome 20 (position 336511)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 327106
KASP Assay ID:
554-1566.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTGCAGAGTCCTAAAAGCTCAGAAAAACTTCAGGAGCAGAGGAAGTA[C/A]ACAGTCTTGGATCTGGTCCGAACGCCTAGAATGAGGAAACAGTCCCTCAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link