pex13

Ensembl ID:
ENSDARG00000071037
ZFIN ID:
ZDB-GENE-040426-1544
Description:
peroxisome biogenesis factor 13 [Source:RefSeq peptide;Acc:NP_956939]
Human Orthologue:
PEX13
Human Description:
peroxisomal biogenesis factor 13 [Source:HGNC Symbol;Acc:8855]
Mouse Orthologue:
Pex13
Mouse Description:
peroxisomal biogenesis factor 13 Gene [Source:MGI Symbol;Acc:MGI:1919379]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42928 Essential Splice Site Mutation detected in F1 DNA During 2017
sa16520 Nonsense Available for shipment Available now
sa42929 Nonsense Mutation detected in F1 DNA During 2017
sa15170 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42928
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021177 Essential Splice Site 24 416 1 4
Genomic Location (Zv9):
Chromosome 17 (position 23755160)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23908602
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATGGGAAAGGCGAATCCCAGGAACCATAACAGCACCGTTAAACTATCG[G/A]TTTGTAAAAACTCGTTGTATTTTGCCCAGTATTTACAAATGTAGCAACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16520
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021177 Nonsense 58 416 2 4
Genomic Location (Zv9):
Chromosome 17 (position 23757835)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23911277
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCAGTTCTAACACGAGTGGTGCCACCGATTCCTCCACGAYCTGTTCGA[C/T]AGTCATACCGCCCRACATACAGCTCGTTTCCCTCCTCGTACAGCCCTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42929
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021177 Nonsense 184 416 2 4
Genomic Location (Zv9):
Chromosome 17 (position 23758215)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23911657
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTCACAAAAGTGCTGTCAGCTTTTGCCCTGGTTAGGACTCTTCGATA[T/A]CTGTATCGCAGGCTGCAGAGGCTGATGGGATTGCGTCAGGGTTCAGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15170
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021177 Essential Splice Site 307 416 4 4
Genomic Location (Zv9):
Chromosome 17 (position 23761768)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23915210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTAAGCGCTGACCTACACCRKGTACTCACTGTTGTTCACTCTCRTTTTC[A/T]GAACAACAGCCMCGGGTGCGTGGCTGGCTGTTAGCCAGTGTGGATGGRCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link