ptena

Ensembl ID:
ENSDARG00000071018
ZFIN ID:
ZDB-GENE-030131-3776
Description:
phosphatase and tensin homolog A [Source:RefSeq peptide;Acc:NP_957002]
Human Orthologue:
PTEN
Human Description:
phosphatase and tensin homolog [Source:HGNC Symbol;Acc:9588]
Mouse Orthologue:
Pten
Mouse Description:
phosphatase and tensin homolog Gene [Source:MGI Symbol;Acc:MGI:109583]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu1864 Nonsense Available for shipment Available now
sa12727 Essential Splice Site Available for shipment Available now
sa42927 Nonsense Mutation detected in F1 DNA During 2017
sa39161 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
hu1864
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104735 Nonsense 43 431 2 9
ENSDART00000104738 Nonsense 43 444 2 9
ENSDART00000122209 Nonsense 43 467 2 10
ENSDART00000128958 Nonsense 43 454 2 10

The following transcripts of ENSDARG00000071018 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 23498331)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23648480
KASP Assay ID:
1105-0001.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATGTCAGACATATACCCTAACATCATTGCCATGGGCTTTCCAGCCGAA[C/T]GATTGGAAGGTGTTTACCGAAACAACATTGATGACGTTGTCCGGTAAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12727
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104735   None 431 None 9
ENSDART00000104738   None 444 None 9
ENSDART00000122209 Essential Splice Site 237 467 7 10
ENSDART00000128958 Essential Splice Site 237 454 7 10

The following transcripts of ENSDARG00000071018 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 23492591)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23642740
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGTGAGGTGAATCCCCAGGGCTTCAAGAAAGGCAGCTGGCACTGGGG[T/C]AAAACGGCATTACTTTACTACTACTGTTAAAGCAAACGTCTTAAWGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42927
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104735 Nonsense 221 431 7 9
ENSDART00000104738 Nonsense 221 444 7 9
ENSDART00000122209 Nonsense 244 467 8 10
ENSDART00000128958 Nonsense 244 454 8 10

The following transcripts of ENSDARG00000071018 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 23489805)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23639954
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACTCTTCCATCTCTGTTTTGTCAAACAGACCCTCAGTTCGTAGTGTAT[C/T]AGTTGAAGGTAAAGATCCACACGTCAAATCCAGCCCACACGCGAAGGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39161
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104735 Nonsense 348 431 8 9
ENSDART00000104738 Nonsense 361 444 8 9
ENSDART00000122209 Nonsense 384 467 9 10
ENSDART00000128958 Nonsense 371 454 9 10

The following transcripts of ENSDARG00000071018 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 23485733)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23635882
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGGAGAGCAGCGAGCGGATGGGGAAAAAGACTACTTGATTTTGACCT[T/A]AACGAAGAACGACTTGGATAAAGCCAACAAAGATAAGGCTAACCGATATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link