nt5e

Ensembl ID:
ENSDARG00000071017
ZFIN ID:
ZDB-GENE-040426-1261
Description:
5'-nucleotidase [Source:RefSeq peptide;Acc:NP_957226]
Human Orthologue:
NT5E
Human Description:
5'-nucleotidase, ecto (CD73) [Source:HGNC Symbol;Acc:8021]
Mouse Orthologues:
4933425L06Rik, Nt5e
Mouse Descriptions:
5' nucleotidase, ecto Gene [Source:MGI Symbol;Acc:MGI:99782]
RIKEN cDNA 4933425L06 gene Gene [Source:MGI Symbol;Acc:MGI:1914013]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8734 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8734
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104740 Essential Splice Site 110 571 None 9
ENSDART00000129938 Essential Splice Site 120 581 None 9
Genomic Location (Zv9):
Chromosome 20 (position 850118)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 805983
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGYGCTGAGGCGGCGTATTTCATGAACCAGCTCAAATACGACGCGATGG[T/A]AAGAAGAACACWGYCGATATTCACACTAGTCTCCAAACTTGRGTTTATAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link