pbxip1a

Ensembl ID:
ENSDARG00000071015
ZFIN ID:
ZDB-GENE-060503-871
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5WW29]
Human Orthologue:
PBXIP1
Human Description:
pre-B-cell leukemia homeobox interacting protein 1 [Source:HGNC Symbol;Acc:21199]
Mouse Orthologue:
Pbxip1
Mouse Description:
pre-B-cell leukemia transcription factor interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:24416

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39227 Essential Splice Site Mutation detected in F1 DNA During 2017
sa13386 Nonsense Available for shipment Available now
sa23441 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39227
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115058 Essential Splice Site 461 751 9 12
ENSDART00000138866 Essential Splice Site 451 741 9 10
ENSDART00000141189 Essential Splice Site 137 158 5 6
Genomic Location (Zv9):
Chromosome 19 (position 8186758)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7645297
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAACTACAGATGCTGAGAGCAAGAGTTGCTGAGCTTACAAAACTAACAG[G/A]TACTGTAAAATAAAAGAAGGAACAGCACATAAAGCTTTTTATTTAGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13386
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115058 Nonsense 484 751 10 12
ENSDART00000138866 Nonsense 474 741 10 10
ENSDART00000141189   None 158 None 6
Genomic Location (Zv9):
Chromosome 19 (position 8187670)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7646209
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACAATCCCTGACTCTGACCCTCCTTCCACTGCTGACTCTGTTCCAGAR[G/T]AGGCAGARAAACACYGGGACAAAAAGGAGGAACTGAAGCGTCAGAAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23441
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115058 Nonsense 604 751 10 12
ENSDART00000138866 Nonsense 594 741 10 10
ENSDART00000141189   None 158 None 6
Genomic Location (Zv9):
Chromosome 19 (position 8188030)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7646569
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAAGAAGAGTGGGACCTTAATAAGGATGAAAGAAGGCAGGAGCGGGAA[C/T]GACGACAGAAGGAAAGACCTTGGGATGCAAAATCTTCCAAACATCAGCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link