arl6ip6

Ensembl ID:
ENSDARG00000071013
ZFIN ID:
ZDB-GENE-070410-117
Description:
ADP-ribosylation-like factor 6 interacting protein 6 [Source:RefSeq peptide;Acc:NP_001082970]
Human Orthologue:
ARL6IP6
Human Description:
ADP-ribosylation-like factor 6 interacting protein 6 [Source:HGNC Symbol;Acc:24048]
Mouse Orthologue:
Arl6ip6
Mouse Description:
ADP-ribosylation factor-like 6 interacting protein 6 Gene [Source:MGI Symbol;Acc:MGI:1929507]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14400 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14400
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104732 Nonsense 111 159 2 4
ENSDART00000110669 Nonsense 111 188 2 4
ENSDART00000125271 Nonsense 111 159 2 4
Genomic Location:
Chromosome 6 (position 13285128)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATAGATTTAAAAACAGAGAAGATAACCACTGAAGATGGATCAGAARTG[C/T]GACTCCTAGGTTGGTCCAGCATAAACCTAAAADTTTGCTATATAYGATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ybvf91n9