LOC794786

Ensembl ID:
ENSDARG00000071012
Human Orthologues:
IFIT1, IFIT1B, IFIT2, IFIT3, IFIT5
Human Descriptions:
interferon-induced protein with tetratricopeptide repeats 1 [Source:HGNC Symbol;Acc:5407]
interferon-induced protein with tetratricopeptide repeats 1B [Source:HGNC Symbol;Acc:23442]
interferon-induced protein with tetratricopeptide repeats 2 [Source:HGNC Symbol;Acc:5409]
interferon-induced protein with tetratricopeptide repeats 3 [Source:HGNC Symbol;Acc:5411]
interferon-induced protein with tetratricopeptide repeats 5 [Source:HGNC Symbol;Acc:13328]
Mouse Orthologues:
2010002M12Rik, Gm14446, I830012O16Rik, Ifit1, Ifit2, Ifit3
Mouse Descriptions:
interferon-induced protein with tetratricopeptide repeats 1 Gene [Source:MGI Symbol;Acc:MGI:99450]
interferon-induced protein with tetratricopeptide repeats 2 Gene [Source:MGI Symbol;Acc:MGI:99449]
interferon-induced protein with tetratricopeptide repeats 3 Gene [Source:MGI Symbol;Acc:MGI:1101055]
predicted gene 14446 Gene [Source:MGI Symbol;Acc:MGI:3650685]
RIKEN cDNA 2010002M12 gene Gene [Source:MGI Symbol;Acc:MGI:2148249]
RIKEN cDNA I830012O16 gene Gene [Source:MGI Symbol;Acc:MGI:3698419]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11515 Nonsense Available for shipment Available now
sa8391 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11515
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104730 Nonsense 182 433 2 2
Genomic Location:
Chromosome 17 (position 23443192)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAGGAAGGAATGGCACAAAGGTCTTGCCWTATCTATGAGCAAAGCATG[T/A]TTATGGTATRAATGCACTCCAGAGCAGAAAGCTGAGATTTTAGAGAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8391
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104730 Nonsense 288 433 2 2
Genomic Location:
Chromosome 17 (position 23442874)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAATATTTCCCAGTTCTTCGACACTTTTGAAAATTCTTGCWAATTTATA[T/A]AAATGGAAAGTGTTCTCCRTGAAGGAGGACAGCAGGGAAAGGCGGATTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2da5yuh7