cdk5r2a

Ensembl ID:
ENSDARG00000071011
ZFIN ID:
ZDB-GENE-050417-22
Description:
cyclin-dependent kinase 5 activator 2 [Source:RefSeq peptide;Acc:NP_001017569]
Human Orthologue:
CDK5R2
Human Description:
cyclin-dependent kinase 5, regulatory subunit 2 (p39) [Source:HGNC Symbol;Acc:1776]
Mouse Orthologue:
Cdk5r2
Mouse Description:
cyclin-dependent kinase 5, regulatory subunit 2 (p39) Gene [Source:MGI Symbol;Acc:MGI:1330828]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9420 Nonsense Available for shipment Available now
sa18835 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9420
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104722 Nonsense 271 308 1 1
ENSDART00000104722 Nonsense 271 308 1 1
Genomic Location:
Chromosome 6 (position 13654564)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGGTGTTYTGGGAGCGCTCGCTGCGGATCATTGACAAAATGAGTGCC[A/T]AAATGCTGCAGATCAACTCAGACCCGCATTTCTTCACYGAGGTCTTCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18835
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104722 Nonsense 271 308 1 1
ENSDART00000104722 Nonsense 271 308 1 1
Genomic Location:
Chromosome 6 (position 13654564)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGGTGTTCTGGGAGCGCTCGCTGCGGATCATTGACAAAATGAGTGCC[A/T]AAATGCTGCAGATCAACTCAGACCCGCATTTCTTCACCGAGGTCTTCCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2z2351i1