si:dkey-204a24.6

Ensembl ID:
ENSDARG00000071010
ZFIN ID:
ZDB-GENE-060503-150
Description:
hypothetical protein LOC100005886 [Source:RefSeq peptide;Acc:NP_001076455]
Human Orthologue:
TUFT1
Human Description:
tuftelin 1 [Source:HGNC Symbol;Acc:12422]
Mouse Orthologue:
Tuft1
Mouse Description:
tuftelin 1 Gene [Source:MGI Symbol;Acc:MGI:109572]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14789 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14789
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104719 Nonsense 180 246 9 12
ENSDART00000146747 Nonsense 180 246 8 10
Genomic Location (Zv9):
Chromosome 19 (position 8369100)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7827639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGKGCTTGCATTTWTTCATTTATATGTYCGTGTGTRTGTTAACAGGTA[C/T]AAAATGCACGAATCCTAATTGACAATAGAAGCRCTCAGGTCAGCGATCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link